Sequence retrieval

Genome: Mycobacterium bovis BCG str. Pasteur 1173P2
Start position: 1121592
End position: 1121618
Length: 27

DNA sequence
>NC_008769, from 1121592 to 1121618 (27 bp); Mycobacterium bovis BCG str. Pasteur 1173P2 CGGCGGCATCGGGGGCATCGGCGGCAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1120850-1123621	Sequence	BCG_1031 PE_PGRS16 PE-PGRS family protein