Sequence retrieval

Genome: Mycobacterium bovis BCG str. Pasteur 1173P2
Start position: 1037145
End position: 1037177
Length: 33

DNA sequence
>NC_008769, from 1037145 to 1037177 (33 bp); Mycobacterium bovis BCG str. Pasteur 1173P2 TGCTCGCGGGGTGCGCGCGGGTTAGTCGCGGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 1037167-1038654	Sequence	BCG_0956c accD3 acetyl-coenzyme A carboxylase carboxyl transferase (subunit beta) accD3 (Protein is coded in complementary strand; from 1038654 to 1037167)