Sequence retrieval

Genome: Mycobacterium bovis BCG str. Pasteur 1173P2
Start position: 1012044
End position: 1012067
Length: 24

DNA sequence
>NC_008769, from 1012044 to 1012067 (24 bp); Mycobacterium bovis BCG str. Pasteur 1173P2 CGTCGACGTCGTCGACGAAGTCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1011881-1013011	Sequence	BCG_0936c serC phosphoserine aminotransferase (Protein is coded in complementary strand; from 1013011 to 1011881)