Sequence retrieval

Genome: Mycobacterium sp. KMS
Start position: 918879
End position: 918902
Length: 24

DNA sequence
>NC_008705, from 918879 to 918902 (24 bp); Mycobacterium sp. KMS TGGCGGTAGCGGCGGCGGTGGCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 918454-920436	Sequence	Mkms_0839 - hypothetical protein (Protein is coded in complementary strand; from 920436 to 918454)