Sequence retrieval

Genome: Mycobacterium sp. KMS
Start position: 761009
End position: 761032
Length: 24

DNA sequence
>NC_008705, from 761009 to 761032 (24 bp); Mycobacterium sp. KMS CGAGGGCGAGCGCGAGCGCGACGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 761005-761874	Sequence	Mkms_0716 - 1,4-dihydroxy-2-naphthoate octaprenyltransferase (Protein is coded in complementary strand; from 761874 to 761005)