Sequence retrieval

Genome: Mycobacterium sp. KMS
Start position: 717038
End position: 717061
Length: 24

DNA sequence
>NC_008705, from 717038 to 717061 (24 bp); Mycobacterium sp. KMS CCAGCGCCCGCGCCCGCGCCAGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 716785-717612	Sequence	Mkms_0661 - nitrilase/cyanide hydratase and apolipoprotein N-acyltransferase (Protein is coded in complementary strand; from 717612 to 716785)