Sequence retrieval

Genome: Mycobacterium sp. KMS
Start position: 630868
End position: 630912
Length: 45

DNA sequence
>NC_008705, from 630868 to 630912 (45 bp); Mycobacterium sp. KMS ACGGCTGTCCGTAGGCGGGCTGGCCGTAGGCCGGCTGACCGTAGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 630357-630974	Sequence	Mkms_0574 - hypothetical protein (Protein is coded in complementary strand; from 630974 to 630357)