Sequence retrieval

Genome: Mycobacterium sp. KMS
Start position: 5722507
End position: 5722542
Length: 36

DNA sequence
>NC_008705, from 5722507 to 5722542 (36 bp); Mycobacterium sp. KMS TTGCCGTTGCCGTTGCCCTTGCCGTTGCCGTTGCCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5722486-5723697	Sequence	Mkms_5484 - serine/threonine protein kinase (Protein is coded in complementary strand; from 5723697 to 5722486)