Sequence retrieval

Genome: Mycobacterium sp. KMS
Start position: 5703829
End position: 5703855
Length: 27

DNA sequence
>NC_008705, from 5703829 to 5703855 (27 bp); Mycobacterium sp. KMS TCTTCGTCGTCTTCGTCGTCTTGGTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5702488-5704242	Sequence	Mkms_5467 - hypothetical protein (Protein is coded in complementary strand; from 5704242 to 5702488)