Sequence retrieval

Genome: Mycobacterium sp. KMS
Start position: 5531468
End position: 5531491
Length: 24

DNA sequence
>NC_008705, from 5531468 to 5531491 (24 bp); Mycobacterium sp. KMS GGTGGCGGGGGCGGGGGCGGCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5531441-5531695	Sequence	Mkms_5293 - hypothetical protein (Protein is coded in complementary strand; from 5531695 to 5531441)