Sequence retrieval

Genome: Mycobacterium sp. KMS
Start position: 5493532
End position: 5493555
Length: 24

DNA sequence
>NC_008705, from 5493532 to 5493555 (24 bp); Mycobacterium sp. KMS GGGGCCGGGGCTGAGGCCGGGACC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5493037-5493912	Sequence	Mkms_5256 - hypothetical protein (Protein is coded in complementary strand; from 5493912 to 5493037)