Sequence retrieval

Genome: Mycobacterium sp. KMS
Start position: 5487866
End position: 5487910
Length: 45

DNA sequence
>NC_008705, from 5487866 to 5487910 (45 bp); Mycobacterium sp. KMS AGGCGGGGGTGGTGGCGGCGGAGGGGGTGGCGGCGGCGGTGGCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5487747-5488481	Sequence	Mkms_5249 - hypothetical protein (Protein is coded in complementary strand; from 5488481 to 5487747)