Sequence retrieval

Genome: Mycobacterium sp. KMS
Start position: 5093498
End position: 5093524
Length: 27

DNA sequence
>NC_008705, from 5093498 to 5093524 (27 bp); Mycobacterium sp. KMS ACCAGCACGACCAGCCCGACCAGCACG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5092169-5093557	Sequence	Mkms_4864 - D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase (Protein is coded in complementary strand; from 5093557 to 5092169)