Sequence retrieval

Genome: Mycobacterium sp. KMS
Start position: 5079190
End position: 5079213
Length: 24

DNA sequence
>NC_008705, from 5079190 to 5079213 (24 bp); Mycobacterium sp. KMS GGTTCGGGTTCGGGCTCGGGTTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5078824-5080164	Sequence	Mkms_4850 - hypothetical protein (Protein is coded in complementary strand; from 5080164 to 5078824)