Sequence retrieval

Genome: Mycobacterium sp. KMS
Start position: 497681
End position: 497704
Length: 24

DNA sequence
>NC_008705, from 497681 to 497704 (24 bp); Mycobacterium sp. KMS CGGGTTCGGGTGCTGGTTCGGCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 497563-500703	Sequence	Mkms_0452 - hypothetical protein (Protein is coded in complementary strand; from 500703 to 497563)