Sequence retrieval

Genome: Mycobacterium sp. KMS
Start position: 4972695
End position: 4972718
Length: 24

DNA sequence
>NC_008705, from 4972695 to 4972718 (24 bp); Mycobacterium sp. KMS CGGCGAGCCGGCGAGCCAGCGAGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4972442-4974517	Sequence	Mkms_4745 - ATP-dependent DNA helicase RecQ (Protein is coded in complementary strand; from 4974517 to 4972442)