Sequence retrieval

Genome: Mycobacterium sp. KMS
Start position: 4923133
End position: 4923168
Length: 36

DNA sequence
>NC_008705, from 4923133 to 4923168 (36 bp); Mycobacterium sp. KMS CCGGCAACGGACCGGGCAACCGACCCGGCAGCGGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4922970-4924724	Sequence	Mkms_4700 - virulence factor Mce family protein (Protein is coded in complementary strand; from 4924724 to 4922970)