Sequence retrieval

Genome: Mycobacterium sp. KMS
Start position: 4838823
End position: 4838846
Length: 24

DNA sequence
>NC_008705, from 4838823 to 4838846 (24 bp); Mycobacterium sp. KMS TGGCGATCGCGACGGCGATGGCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4838678-4839772	Sequence	Mkms_4609 - arsenical-resistance protein (Protein is coded in complementary strand; from 4839772 to 4838678)