Sequence retrieval

Genome: Mycobacterium sp. KMS
Start position: 4836989
End position: 4837012
Length: 24

DNA sequence
>NC_008705, from 4836989 to 4837012 (24 bp); Mycobacterium sp. KMS ACCCGAGCCCGAGCCCGACCCCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4835964-4837103	Sequence	Mkms_4606 - phosphate ABC transporter, periplasmic phosphate-binding protein (Protein is coded in complementary strand; from 4837103 to 4835964)