Sequence retrieval

Genome: Mycobacterium sp. KMS
Start position: 470281
End position: 470316
Length: 36

DNA sequence
>NC_008705, from 470281 to 470316 (36 bp); Mycobacterium sp. KMS CACCAGCACGACCACGAGCACCACCGTCAGCACGAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 470192-470314	Sequence	Mkms_0426 - hypothetical protein (Protein is coded in complementary strand; from 470314 to 470192)