Sequence retrieval

Genome: Mycobacterium sp. KMS
Start position: 4692460
End position: 4692483
Length: 24

DNA sequence
>NC_008705, from 4692460 to 4692483 (24 bp); Mycobacterium sp. KMS CGCCGCGACGCCGCCACGCCGCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4692414-4693508	Sequence	Mkms_4460 - carboxylate-amine ligase (Protein is coded in complementary strand; from 4693508 to 4692414)