Sequence retrieval

Genome: Mycobacterium sp. KMS
Start position: 4641053
End position: 4641076
Length: 24

DNA sequence
>NC_008705, from 4641053 to 4641076 (24 bp); Mycobacterium sp. KMS GACCTTGACCTGGGCCTTGACCAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4640040-4641203	Sequence	Mkms_4413 sucC succinyl-CoA synthetase subunit beta (Protein is coded in complementary strand; from 4641203 to 4640040)