Sequence retrieval

Genome: Mycobacterium sp. KMS
Start position: 4632814
End position: 4632858
Length: 45

DNA sequence
>NC_008705, from 4632814 to 4632858 (45 bp); Mycobacterium sp. KMS TGGGGGCACTGTCGTTGGGGGGACTGTCGTTGGGGGCACTGTCGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4632792-4634210	Sequence	Mkms_4407 - hypothetical protein (Protein is coded in complementary strand; from 4634210 to 4632792)