Sequence retrieval

Genome: Mycobacterium sp. KMS
Start position: 4519391
End position: 4519414
Length: 24

DNA sequence
>NC_008705, from 4519391 to 4519414 (24 bp); Mycobacterium sp. KMS TCGCCGTCGCGGTGGCCGTCGCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4518002-4520512	Sequence	Mkms_4295 - osmosensitive K+ channel signal transduction histidine kinase