Sequence retrieval

Genome: Mycobacterium sp. KMS
Start position: 4486633
End position: 4486656
Length: 24

DNA sequence
>NC_008705, from 4486633 to 4486656 (24 bp); Mycobacterium sp. KMS CGTCGACGTGGAGGTCGACGTCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4486460-4487119	Sequence	Mkms_4261 - copper/zinc binding superoxide dismutase (Protein is coded in complementary strand; from 4487119 to 4486460)