Sequence retrieval

Genome: Mycobacterium sp. KMS
Start position: 4425206
End position: 4425229
Length: 24

DNA sequence
>NC_008705, from 4425206 to 4425229 (24 bp); Mycobacterium sp. KMS GCGTCGGCGACGTCGTCGGCGTGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4424801-4425877	Sequence	Mkms_4198 - NAD-dependent epimerase/dehydratase (Protein is coded in complementary strand; from 4425877 to 4424801)