Sequence retrieval

Genome: Mycobacterium sp. KMS
Start position: 4392738
End position: 4392764
Length: 27

DNA sequence
>NC_008705, from 4392738 to 4392764 (27 bp); Mycobacterium sp. KMS CCGGCCTCACCGGTCTCATCGGCCTCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4392255-4392896	Sequence	Mkms_4164 - hypothetical protein (Protein is coded in complementary strand; from 4392896 to 4392255)