Sequence retrieval

Genome: Mycobacterium sp. KMS
Start position: 4353126
End position: 4353149
Length: 24

DNA sequence
>NC_008705, from 4353126 to 4353149 (24 bp); Mycobacterium sp. KMS CACGGCCACGGACACCGCCACGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4352551-4353882	Sequence	Mkms_4120 pimE mannosyltransferase (Protein is coded in complementary strand; from 4353882 to 4352551)