Sequence retrieval

Genome: Mycobacterium sp. KMS
Start position: 4228902
End position: 4228925
Length: 24

DNA sequence
>NC_008705, from 4228902 to 4228925 (24 bp); Mycobacterium sp. KMS TGAGATCGAGATTGAGGTCGAGAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4228589-4229740	Sequence	Mkms_4009 - metallophosphoesterase (Protein is coded in complementary strand; from 4229740 to 4228589)