Sequence retrieval

Genome: Mycobacterium sp. KMS
Start position: 4225485
End position: 4225529
Length: 45

DNA sequence
>NC_008705, from 4225485 to 4225529 (45 bp); Mycobacterium sp. KMS CTTCTTCACGGGAGCCTTCTTTACGGGAGCCTTCTTTGCGGGCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4225285-4225854	Sequence	Mkms_4007 - hypothetical protein (Protein is coded in complementary strand; from 4225854 to 4225285)