Sequence retrieval

Genome: Mycobacterium sp. KMS
Start position: 4211751
End position: 4211786
Length: 36

DNA sequence
>NC_008705, from 4211751 to 4211786 (36 bp); Mycobacterium sp. KMS CCCGGACCGCCGCCGGGCCCGCCGCCCGGTCCCCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4210749-4212617	Sequence	Mkms_3996 - glycosyl transferase family protein (Protein is coded in complementary strand; from 4212617 to 4210749)