Sequence retrieval

Genome: Mycobacterium sp. KMS
Start position: 4180167
End position: 4180211
Length: 45

DNA sequence
>NC_008705, from 4180167 to 4180211 (45 bp); Mycobacterium sp. KMS GCCTTCACCTCGGGGGCCTTCACCTCGGGGGCCTTCACCTCGGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4178628-4180619	Sequence	Mkms_3967 - transcription termination factor Rho (Protein is coded in complementary strand; from 4180619 to 4178628)