Sequence retrieval

Genome: Mycobacterium sp. KMS
Start position: 4172833
End position: 4172877
Length: 45

DNA sequence
>NC_008705, from 4172833 to 4172877 (45 bp); Mycobacterium sp. KMS TCGAAAACAGCGTCCCCGAGAGCAGCGTCCTCGAAAACAGCGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4172740-4173651	Sequence	Mkms_3960 - HemK family modification methylase (Protein is coded in complementary strand; from 4173651 to 4172740)