Sequence retrieval

Genome: Mycobacterium sp. KMS
Start position: 4144912
End position: 4144938
Length: 27

DNA sequence
>NC_008705, from 4144912 to 4144938 (27 bp); Mycobacterium sp. KMS TCGAAGAGCTCGAACAGCTCGATGAGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4144855-4145754	Sequence	Mkms_3936 - thioredoxin domain-containing protein (Protein is coded in complementary strand; from 4145754 to 4144855)