Sequence retrieval

Genome: Mycobacterium sp. KMS
Start position: 3933251
End position: 3933274
Length: 24

DNA sequence
>NC_008705, from 3933251 to 3933274 (24 bp); Mycobacterium sp. KMS GCGTCGGCGTCCTCGTCGGCGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3931259-3940492	Sequence	Mkms_3721 - fatty acid synthase (Protein is coded in complementary strand; from 3940492 to 3931259)