Sequence retrieval

Genome: Mycobacterium sp. KMS
Start position: 3897613
End position: 3897648
Length: 36

DNA sequence
>NC_008705, from 3897613 to 3897648 (36 bp); Mycobacterium sp. KMS TTCTTGGCGGCCTTCTTGGCGGCCTTCTTGGCCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3897505-3899190	Sequence	Mkms_3692 - 1-acyl-sn-glycerol-3-phosphate acyltransferase (Protein is coded in complementary strand; from 3899190 to 3897505)