Sequence retrieval

Genome: Mycobacterium sp. KMS
Start position: 3847387
End position: 3847431
Length: 45

DNA sequence
>NC_008705, from 3847387 to 3847431 (45 bp); Mycobacterium sp. KMS CCGCCGTCCTCGTCGCCGGCATCCTCGTCGCCGCCGGTCACGTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3847252-3848634	Sequence	Mkms_3653 - hypothetical protein (Protein is coded in complementary strand; from 3848634 to 3847252)