Sequence retrieval

Genome: Mycobacterium sp. KMS
Start position: 3845439
End position: 3845468
Length: 30

DNA sequence
>NC_008705, from 3845439 to 3845468 (30 bp); Mycobacterium sp. KMS GTGTCGGAGTCGGCGTCGGAGTCGGCGTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3845391-3846827	Sequence	Mkms_3652 tig trigger factor (Protein is coded in complementary strand; from 3846827 to 3845391)