Sequence retrieval

Genome: Mycobacterium sp. KMS
Start position: 3812482
End position: 3812511
Length: 30

DNA sequence
>NC_008705, from 3812482 to 3812511 (30 bp); Mycobacterium sp. KMS GTCGTCGTCCTCTTCGTCGTCGTCGTTGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3812288-3815263	Sequence	Mkms_3624 - ribonuclease (Protein is coded in complementary strand; from 3815263 to 3812288)