Sequence retrieval

Genome: Mycobacterium sp. KMS
Start position: 3770229
End position: 3770258
Length: 30

DNA sequence
>NC_008705, from 3770229 to 3770258 (30 bp); Mycobacterium sp. KMS CTGCTGCTGCTGTTGCTGCTGCTGCAGCTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3770227-3771930	Sequence	Mkms_3581 - hypothetical protein (Protein is coded in complementary strand; from 3771930 to 3770227)