Sequence retrieval

Genome: Mycobacterium sp. KMS
Start position: 3574147
End position: 3574182
Length: 36

DNA sequence
>NC_008705, from 3574147 to 3574182 (36 bp); Mycobacterium sp. KMS GGTCGGCCAGGCGGTCCGCGAGGCGCTCGGCCAGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3573267-3574289	Sequence	Mkms_3407 - hypothetical protein (Protein is coded in complementary strand; from 3574289 to 3573267)