Sequence retrieval

Genome: Mycobacterium sp. KMS
Start position: 3522312
End position: 3522335
Length: 24

DNA sequence
>NC_008705, from 3522312 to 3522335 (24 bp); Mycobacterium sp. KMS CGGCGGCGGTGGTGGCGGCGGCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3521890-3522783	Sequence	Mkms_3358 - hypothetical protein (Protein is coded in complementary strand; from 3522783 to 3521890)