Sequence retrieval

Genome: Mycobacterium sp. KMS
Start position: 3489261
End position: 3489296
Length: 36

DNA sequence
>NC_008705, from 3489261 to 3489296 (36 bp); Mycobacterium sp. KMS CGGGAGCCGGCGCGGGAGCCGGCGCGGGAGCCGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3489095-3490207	Sequence	Mkms_3325 - FHA domain-containing protein (Protein is coded in complementary strand; from 3490207 to 3489095)