Sequence retrieval

Genome: Mycobacterium sp. KMS
Start position: 348069
End position: 348113
Length: 45

DNA sequence
>NC_008705, from 348069 to 348113 (45 bp); Mycobacterium sp. KMS TCGTAGTTCATGGCACCGAAGTTCATGGCACCGTAGTTCACAGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 346491-348095	Sequence	Mkms_0312 - hypothetical protein (Protein is coded in complementary strand; from 348095 to 346491)
ORF... 348107-348895	Sequence	Mkms_0313 - short-chain dehydrogenase/reductase SDR (Protein is coded in complementary strand; from 348895 to 348107)