Sequence retrieval

Genome: Mycobacterium sp. KMS
Start position: 3386581
End position: 3386604
Length: 24

DNA sequence
>NC_008705, from 3386581 to 3386604 (24 bp); Mycobacterium sp. KMS CCTGGTTCTGGTTCTGGTTCTGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3386041-3387540	Sequence	Mkms_3228 - putative plasmid replication initiator protein (Protein is coded in complementary strand; from 3387540 to 3386041)