Sequence retrieval

Genome: Mycobacterium sp. KMS
Start position: 3378774
End position: 3378797
Length: 24

DNA sequence
>NC_008705, from 3378774 to 3378797 (24 bp); Mycobacterium sp. KMS CGACGCCGACGATGACGCCGTCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3378410-3379240	Sequence	Mkms_3220 - undecaprenyl pyrophosphate phosphatase (Protein is coded in complementary strand; from 3379240 to 3378410)