Sequence retrieval

Genome: Mycobacterium sp. KMS
Start position: 3370508
End position: 3370552
Length: 45

DNA sequence
>NC_008705, from 3370508 to 3370552 (45 bp); Mycobacterium sp. KMS GGGCCCAGGATTTTTCGGCCCGGGAATTTTCGGCTCAGGAATTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3366777-3370571	Sequence	Mkms_3211 metH B12-dependent methionine synthase (Protein is coded in complementary strand; from 3370571 to 3366777)