Sequence retrieval

Genome: Mycobacterium sp. KMS
Start position: 3207672
End position: 3207698
Length: 27

DNA sequence
>NC_008705, from 3207672 to 3207698 (27 bp); Mycobacterium sp. KMS CGATCGCGATGATCGCGACCATCGCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3206705-3207985	Sequence	Mkms_3064 - inner-membrane translocator (Protein is coded in complementary strand; from 3207985 to 3206705)