Sequence retrieval

Genome: Mycobacterium sp. KMS
Start position: 3103595
End position: 3103621
Length: 27

DNA sequence
>NC_008705, from 3103595 to 3103621 (27 bp); Mycobacterium sp. KMS GGCACCGCCGACACCGCCGACACCGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3103226-3103912	Sequence	Mkms_2972 cmk cytidylate kinase (Protein is coded in complementary strand; from 3103912 to 3103226)