Sequence retrieval

Genome: Mycobacterium sp. KMS
Start position: 3094273
End position: 3094299
Length: 27

DNA sequence
>NC_008705, from 3094273 to 3094299 (27 bp); Mycobacterium sp. KMS GTGTCCGTTGTGTCCGTTGTGTCCGTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3094249-3095349	Sequence	Mkms_2962 - hypothetical protein (Protein is coded in complementary strand; from 3095349 to 3094249)